View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6518_low_50 (Length: 240)
Name: NF6518_low_50
Description: NF6518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6518_low_50 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 122 - 240
Target Start/End: Original strand, 42335337 - 42335455
Alignment:
| Q |
122 |
ctactttatttagaaattgaatttgtgaatagtattacaaattaacttccttaattagatgccgtgtcaatctcataaataaattttaagttacaatgga |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42335337 |
ctactttatttagaaattgaatttgtgaatagtattacaaattaacttccttaattagatgccgtgtcaatctcataaataaattttaagttacaatgga |
42335436 |
T |
|
| Q |
222 |
agattaaggattgtaaatt |
240 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
42335437 |
agattaaggattgtaaatt |
42335455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 17 - 69
Target Start/End: Original strand, 42335232 - 42335284
Alignment:
| Q |
17 |
aatgtggttataaacaaggtgtgacatgtttcttaagtcctacttcaacatgc |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42335232 |
aatgtggttataaacaaggtgtgacatgtttcttaagtcctacttcaacatgc |
42335284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University