View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6518_low_52 (Length: 238)
Name: NF6518_low_52
Description: NF6518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6518_low_52 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 4659982 - 4660206
Alignment:
| Q |
1 |
tcctgcaaactttatagctgttaattagtttatatggtgaagagtctatcataccataatctggaaaagataaatatcgttttattaaaaatttaattaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4659982 |
tcctgcaaactttatagctgttaattagtttatatggtgaagagtctatcatgccataatctggaaaagataaatatcgttttattaaaaatttaattaa |
4660081 |
T |
|
| Q |
101 |
atcttaatgataagttcaaataatcaaacacaggaaggtttaccttgaaa---tattaagatatgatcaaacgatatcttttatgtagagctaaaataat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4660082 |
gtcttaatgataagttcaaataatcaaacataggaaggtttaccttgaaatagtattaagatatgatcaaacgatatcttttatgtagagctaaaataat |
4660181 |
T |
|
| Q |
198 |
ttagtttttgctttatatatgttta |
222 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
4660182 |
ttagtttttgctttatatatgttta |
4660206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University