View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6518_low_53 (Length: 238)
Name: NF6518_low_53
Description: NF6518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6518_low_53 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 17 - 238
Target Start/End: Original strand, 3124173 - 3124394
Alignment:
| Q |
17 |
acattttggggacaaggtgattctcgaagatccaatagagaggtactatagtttatttcaattgctggaaacatttgttaattccacaaattttgaattt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3124173 |
acattttggggacaaggtgattctcgaagatccaatagagaggtactatagtttatttcaattgctggaaacatttgttaattccacaaattttgaattt |
3124272 |
T |
|
| Q |
117 |
cagctccaattggagattttttactcattactaaatttgctgttcaaaatggtttcgcatggtatatttgagtgatagcagaattattttatttgtgtca |
216 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3124273 |
cagctccaattggagatttttgactcactactaaatttgctgttcaaaatggtttcacatggtatatttgagtgatagcagaattattttatttgtgtca |
3124372 |
T |
|
| Q |
217 |
ctgccctatcagtatcagtaat |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
3124373 |
ctgccctatcagtatcagtaat |
3124394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University