View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6518_low_55 (Length: 233)
Name: NF6518_low_55
Description: NF6518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6518_low_55 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 22 - 123
Target Start/End: Original strand, 5454990 - 5455092
Alignment:
| Q |
22 |
ggacagaatttgggacgctactgtcctgcttataatgcatctactatttgtgattattgcaattatgca-gaacttacaatgataaaaaatgtggaacca |
120 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||| | |||||||||||||||||||||| |||| || ||||| ||||| |||||| ||| |
|
|
| T |
5454990 |
ggacagaatttgggacgctactggcctgcttataaagcatctggttcttgtgattattgcaattatgcaggaacctataatgagaaaaagtgtggatcca |
5455089 |
T |
 |
| Q |
121 |
act |
123 |
Q |
| |
|
||| |
|
|
| T |
5455090 |
act |
5455092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 154 - 216
Target Start/End: Original strand, 5455286 - 5455345
Alignment:
| Q |
154 |
ggtgtgtctttggttagaaggagggatatagatagtgtttgtgctgatatttatgagtggcag |
216 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5455286 |
ggtgtgtctttggttagaagg---gatatagatagtgtttgtgctgatatttatgagtggcag |
5455345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 175 - 216
Target Start/End: Complemental strand, 42986465 - 42986424
Alignment:
| Q |
175 |
agggatatagatagtgtttgtgctgatatttatgagtggcag |
216 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
42986465 |
agggatatagatagtgtatgtgcagatatttatgagtggcag |
42986424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University