View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6519_low_4 (Length: 311)
Name: NF6519_low_4
Description: NF6519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6519_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 16 - 295
Target Start/End: Original strand, 26528709 - 26528984
Alignment:
| Q |
16 |
atggaaaaggaaattgtgatggaacataataaaggggttagctttgagtcaaaatttgttgatgcaattgatcttggttgttgtccagatgattggttga |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26528709 |
atggaaaaggaaattgtgatggaacataataaaggggttagctttgagtcaaaatttgtggatgcaattgatcttggttgttgtccagatgattggttga |
26528808 |
T |
 |
| Q |
116 |
ttattccaccaatggaaaaggatttgggagacaaacttgttccatagaacaatggcatttatgattttcnnnnnnnnnnactttctattttcgatggctt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26528809 |
ttattccaccaatggaaaaggatttgggagacaaacttgttccatagaacaatggcatttatgatttt----tttttttactttctattttcgatggctt |
26528904 |
T |
 |
| Q |
216 |
aatgtagtaaatcttaattttatgatcttgtgtaatattgctaatataatgttatatattcctttacttttcgttctttt |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26528905 |
aatgtagtaaatcttaattttatgatcttgtgtaatattgctaatataatgttatatattcctttacttttcgttctttt |
26528984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University