View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6521_high_3 (Length: 371)
Name: NF6521_high_3
Description: NF6521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6521_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 1 - 358
Target Start/End: Complemental strand, 42632573 - 42632209
Alignment:
| Q |
1 |
aaatgacttgaccctgtactccaatctttctctatctctcactattcacgtaatggccaagtttctcttaacaccggtt--------ttccaaaaagcca |
92 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42632573 |
aaatgacttgaccctgtactccaatctctctctatctctctctattcacgtaatggccaagtttctcttaacaccggttcaccggttttccaaaaagcca |
42632474 |
T |
 |
| Q |
93 |
cccggccggtccgagccaatactgaaaatgacacagcgttgaatgtaaagtaaccacgtacaaggtttgacttgtaaaatacttaactccaaatttgtct |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42632473 |
cccggccggtccgagccaatactgaaaatgacacagcgttgaatgtaaagtaaccacgtacaaggtttgacttgtaaaatacttaactccaaatttgtct |
42632374 |
T |
 |
| Q |
193 |
cattgtagatagcatttaatgcaaaattgtcacattagagtgatagtgaccaaatctcaatctcatctccaactccataaatcattccatttcattcatt |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42632373 |
cattgtagatagcatttaatgcaaaattgtcacattagagtgatagtgaccaaatctcaatctcatctccaactccataaatcattccatttcattcatt |
42632274 |
T |
 |
| Q |
293 |
cattcttcatccccaaatcttcactctctctttctcaactttccaaaatgggttcagctgaaaatg |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42632273 |
cattcttcatccccaaatcttcactctctc-ttctcaactttccaaaatgggttcagctgaaaatg |
42632209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University