View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6521_low_10 (Length: 252)
Name: NF6521_low_10
Description: NF6521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6521_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 90 - 245
Target Start/End: Complemental strand, 29052414 - 29052259
Alignment:
| Q |
90 |
ttggtgtttgtcgaagtactggatttgcgagtcattttcttccctctgtcatgcctcaccagttgcagccaagcatcaatggtacctaaattcctttctc |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29052414 |
ttggtgtttgtcgaagtactggatttgcgagtcattttcttccctctgtcatgcctcaccagttgcagccaagtatcaatggtacctaaattcctttctc |
29052315 |
T |
|
| Q |
190 |
ccttgctggtctcatttttcagtaaggtaggatcgaagaccttttaatattcttgg |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29052314 |
ccttgctggtctcatttttcagtaaggtaggatcgaagaccttttaatatttttgg |
29052259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 29052541 - 29052449
Alignment:
| Q |
1 |
cttccttattccacaaacccttcgtttagtgcaggtactccaaccaccactggacataagagtataccttgttgcagccttctcccctattgg |
93 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29052541 |
cttccttattccacaaactcttcgtttagtggaggtactccaaccaccactggacataagagtataccttgttgcagccttctcccctattgg |
29052449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University