View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6522_low_11 (Length: 262)
Name: NF6522_low_11
Description: NF6522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6522_low_11 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 22 - 262
Target Start/End: Original strand, 3106827 - 3107067
Alignment:
| Q |
22 |
atgaagaaacaaaaacgtgaatatcaatgcaaaatgagaaaagggacaaagttggttgcttctttcttggggaactccaagctcgatgcccatatatatt |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3106827 |
atgaagaaacaaaaacgtgaatatcaatgcaaaatgagaaaagtgacaaagttggttgcttctttcttggggaactccaagctcgatgcccatatatatt |
3106926 |
T |
 |
| Q |
122 |
taccaatctgctctgctcgtgagataggtttaactttatttgcatcacaagtcacacgcttaaccatatgtgtcttagtgctttgtgccataaatttcca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3106927 |
taccaatctgctctgctcgtgagataggtttaactttatttgcatcacaagtcacacgcttaaccatatgtgtcttagtgctttgtgccataaatttcca |
3107026 |
T |
 |
| Q |
222 |
tgtgaccctgtctacgtctctctgtgggttgacgtagtaac |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3107027 |
tgtgaccctgtctacgtctctctgtgggttgacgtagtaac |
3107067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University