View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6522_low_7 (Length: 324)
Name: NF6522_low_7
Description: NF6522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6522_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 19 - 306
Target Start/End: Complemental strand, 40570439 - 40570151
Alignment:
| Q |
19 |
gcatcatggcaacatatattgattatatgtaactgtctctctatgactcaaaattttgatgcgaaaaggtcctatgactgtt-gtgcctaattaaagatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40570439 |
gcatcatggcaacatatattgattatatgtaactgtctctctatgactcaaaattttgatgcgaaaaggtcctatgactgttagtgcctaattaaagatt |
40570340 |
T |
|
| Q |
118 |
cgatctcacatgcaaaattcatcattcttcctgcttagggagctttcgttttgttttcttctgaggggaatattggtaaagctatgcgatctagttctgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40570339 |
cgatctcacatgcaaaattcatcattcttcctgcttagggagctttcgttttgttttcttctgaggggaatattggtaaagctatgcgatctagttctgg |
40570240 |
T |
|
| Q |
218 |
cttttttaattaataagtaaaagtttatttagataataaagatattagtacttagtacctggatcaatattcaatgaagaacaaagctt |
306 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40570239 |
cttttttaattaataagcaaaagtttatttagataataaagatattagtacttagtacctggatcaatattcaatgaagaacaaagctt |
40570151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University