View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6523_high_21 (Length: 205)
Name: NF6523_high_21
Description: NF6523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6523_high_21 |
 |  |
|
| [»] scaffold0174 (2 HSPs) |
 |  |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0174 (Bit Score: 47; Significance: 5e-18; HSPs: 2)
Name: scaffold0174
Description:
Target: scaffold0174; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 113 - 175
Target Start/End: Original strand, 30490 - 30552
Alignment:
| Q |
113 |
agagctgagattggtgggtgcagtcttgaccttttgctttcgtttcataaactcgaaagggtc |
175 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| || ||||||||||| |||||||||| |
|
|
| T |
30490 |
agagctgagattggtgggtgcagacttgaccttttgcgttggtttcataaacccgaaagggtc |
30552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0174; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 160 - 205
Target Start/End: Original strand, 30562 - 30607
Alignment:
| Q |
160 |
taaactcgaaagggtctgtttggttactaacgtattggactcatcc |
205 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30562 |
taaacccgaaagggtctgtttggttactaacgtattggactcatcc |
30607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 113 - 174
Target Start/End: Original strand, 4730610 - 4730671
Alignment:
| Q |
113 |
agagctgagattggtgggtgcagtcttgaccttttgctttcgtttcataaactcgaaagggt |
174 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||| ||||||||| | ||||||||| |
|
|
| T |
4730610 |
agagctgagattgatgggtgcagacttgaccttttgctttggtttcataatcccgaaagggt |
4730671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 160 - 205
Target Start/End: Original strand, 4730682 - 4730727
Alignment:
| Q |
160 |
taaactcgaaagggtctgtttggttactaacgtattggactcatcc |
205 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4730682 |
taaacccgaaagggtctgtttggttactaacgtattggactcatcc |
4730727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 166 - 203
Target Start/End: Complemental strand, 39711761 - 39711724
Alignment:
| Q |
166 |
cgaaagggtctgtttggttactaacgtattggactcat |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39711761 |
cgaaagggtctgtttggttactaacgtattgaactcat |
39711724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 166 - 205
Target Start/End: Original strand, 35243106 - 35243145
Alignment:
| Q |
166 |
cgaaagggtctgtttggttactaacgtattggactcatcc |
205 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
35243106 |
cgaaagggtctgtttggttactagcgtaatggactcatcc |
35243145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 205
Target Start/End: Complemental strand, 12419587 - 12419559
Alignment:
| Q |
177 |
gtttggttactaacgtattggactcatcc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
12419587 |
gtttggttactaacgtattggactcatcc |
12419559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 205
Target Start/End: Complemental strand, 12431647 - 12431619
Alignment:
| Q |
177 |
gtttggttactaacgtattggactcatcc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
12431647 |
gtttggttactaacgtattggactcatcc |
12431619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 128 - 177
Target Start/End: Complemental strand, 2688569 - 2688520
Alignment:
| Q |
128 |
gggtgcagtcttgaccttttgctttcgtttcataaactcgaaagggtctg |
177 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
2688569 |
gggtgcagtcttgaccttttgctttggtttcataaacccgaaagggtctg |
2688520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 160 - 205
Target Start/End: Complemental strand, 2688512 - 2688467
Alignment:
| Q |
160 |
taaactcgaaagggtctgtttggttactaacgtattggactcatcc |
205 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2688512 |
taaacccgaaagagtctgtttggttactaacgtattggactcatcc |
2688467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 154 - 205
Target Start/End: Complemental strand, 21481228 - 21481177
Alignment:
| Q |
154 |
gtttcataaactcgaaagggtctgtttggttactaacgtattggactcatcc |
205 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
21481228 |
gtttcaaaaactcgaaagggtctgtttggttactcacgaattggactcatcc |
21481177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 205
Target Start/End: Original strand, 10623350 - 10623378
Alignment:
| Q |
177 |
gtttggttactaacgtattggactcatcc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10623350 |
gtttggttactaacgtattggactcatcc |
10623378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 205
Target Start/End: Complemental strand, 28302207 - 28302175
Alignment:
| Q |
173 |
gtctgtttggttactaacgtattggactcatcc |
205 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
28302207 |
gtctatttggttactaacgtattggactcatcc |
28302175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 205
Target Start/End: Complemental strand, 17459258 - 17459209
Alignment:
| Q |
154 |
gtttcataaactcgaaagggtctgtttggttactaacgtattggactcatcc |
205 |
Q |
| |
|
|||||| |||| ||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
17459258 |
gtttcaaaaacccgaaagggtctgt--gattactaacgtattggactcatcc |
17459209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University