View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6523_low_13 (Length: 329)
Name: NF6523_low_13
Description: NF6523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6523_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 198 - 307
Target Start/End: Original strand, 46936517 - 46936627
Alignment:
| Q |
198 |
gccagcagtaaaaactaaagcagcaccctgggaacttacttgaattactttg-cgacaagactaacatccaacaagactaacaaccaacaccccgggttt |
296 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46936517 |
gccagcagtaaaaactaaagcagcaccccgggaacttacttgaattacttcgtcgacaagactaacatccaacaagactaacaaccaacaccccgggttt |
46936616 |
T |
 |
| Q |
297 |
tagtgcaccat |
307 |
Q |
| |
|
||||||||||| |
|
|
| T |
46936617 |
tagtgcaccat |
46936627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 46936400 - 46936515
Alignment:
| Q |
1 |
ataatgacaccatcatcatccttctaaaaattatattcacatgataaataagtgtgtattgtggtgcagtgcgtaagatgtagtaaaccaggatttaaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | | |||||||| |
|
|
| T |
46936400 |
ataatgacaccatcatcatccttctaaaaattatattcacatgataaataagtttgtattgtggtgcagtgcgtaagtt----------tgtatttaaga |
46936489 |
T |
 |
| Q |
101 |
agtccataattggctttttgtgcatt |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
46936490 |
agtccataattggctttttgtgcatt |
46936515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University