View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6523_low_16 (Length: 252)
Name: NF6523_low_16
Description: NF6523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6523_low_16 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 74 - 252
Target Start/End: Original strand, 42206463 - 42206641
Alignment:
| Q |
74 |
cattatttcaaatcaaatgaacctttttaattttgcgtggttcaagtggtcggtggtttgagtctcttgagcatgtggtcatggttcaatctctaactca |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42206463 |
cattatttcaaatcaaatgaacctttttaattttgcgtggttcaagtggtcggtggtttgagtctcttgagcatgtggtcatggttcaatctctaactca |
42206562 |
T |
 |
| Q |
174 |
tttgtattaaaattcaccatttgagaaagacaactcttaaatgtgcttcgaattttcgaatgaattagatgcagttgca |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42206563 |
tttgtattaaaattcaccatttgagaaagacaactcttaaatgtgcttcgagttttcgaatgaattagatgcagttgca |
42206641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 10 - 38
Target Start/End: Original strand, 42206399 - 42206427
Alignment:
| Q |
10 |
attattctatctgtaagggagaatatttg |
38 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42206399 |
attattctatctgtaagggagaatatttg |
42206427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University