View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6523_low_7 (Length: 434)
Name: NF6523_low_7
Description: NF6523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6523_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 373; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 373; E-Value: 0
Query Start/End: Original strand, 20 - 424
Target Start/End: Complemental strand, 5845461 - 5845056
Alignment:
| Q |
20 |
cttttgatgggaatggtagtaacaaacagagagaaaatattgcaagatttgagattgatgagagtgaatttagacacccaattgttagggaggtttgtag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5845461 |
cttttgatgggaatggtagtaacaaacagagagaaaatattgcaagatttgagattgatgagagtgaatttagacacccaattgttagggaggtttgtag |
5845362 |
T |
 |
| Q |
120 |
gttgatttcacttaggtcaaattggaatcctaaatttgaagaaaatttgaggcatttattaaggagtcttaatcctcgacttgtttgtgctgttttgcgg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5845361 |
gttgatttcacttaggtcaaattggaatcctaaatttgaagaaaatttgaggcatttattaaggagtcttaatcctcgacttgtttgtgctgttttgcgg |
5845262 |
T |
 |
| Q |
220 |
tctcaggatgatgaaaggattgctttgga-nnnnnnnactgggctgataggcaatggcggtataggcatgatgctattgtgtactatacgatgttggata |
318 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5845261 |
tctcaggatgatgaaaggattgctttggattttttttactgggctgataggcaatggcggtataggcatgatgctattgtgtactatacgatgttggata |
5845162 |
T |
 |
| Q |
319 |
tacttagcaagaccaggttgtgtcaaggagcaaggcggattcttcggcttatgactcgccgaggaattgaacgttcgcctgaggcttttagttatgtgat |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5845161 |
tacttagcaagaccaggttgtgtcaaggagcaaggcggattcttcggcttatgactcgccgaggaattgaacgttcgcctgaggcttttagttatgtgat |
5845062 |
T |
 |
| Q |
419 |
gatgtc |
424 |
Q |
| |
|
| |||| |
|
|
| T |
5845061 |
ggtgtc |
5845056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University