View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6525_low_10 (Length: 235)
Name: NF6525_low_10
Description: NF6525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6525_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 19 - 225
Target Start/End: Original strand, 37614367 - 37614573
Alignment:
| Q |
19 |
aaatcagaggtatacaatggagatgaaatctgccaagcaaagtccaaggaacttctcttggaaataaacctaccaaatggtcttttacctttgaaggaca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37614367 |
aaatcagaggtatacaatggagatgaaatctgccaagcaaagtccaaggaacttctcttggaaataaacctaccaaatggtcttttacctttgaaggaca |
37614466 |
T |
|
| Q |
119 |
ttgaagaatgtggttatcatagggagagtggttttgtttggcttaagcagaaagcaagctatactcacaagtttgagaaagttgataggcttgtgaccta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37614467 |
ttgaagaatgtggttatcatagggagagtggttttgtttggcttaagcagaaagcaagctatactcacaagtttgagaaagttgataggcttgtgaccta |
37614566 |
T |
|
| Q |
219 |
tgctact |
225 |
Q |
| |
|
|| |||| |
|
|
| T |
37614567 |
tggtact |
37614573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University