View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6525_low_4 (Length: 324)
Name: NF6525_low_4
Description: NF6525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6525_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 297; Significance: 1e-167; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 1 - 313
Target Start/End: Original strand, 45938318 - 45938630
Alignment:
| Q |
1 |
caaatgatgcaatggcaatcagcagtgagggatggtttacttgaagcaggggttttaccttacaatggttttgcttttgatcacttgtatgggactaagg |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45938318 |
caaatgatgcaatggtaatcagcagtgagggatggtttacctgaagcaggggttttaccttacaatggttttgcttttgatcacttgtatgggactaagg |
45938417 |
T |
 |
| Q |
101 |
ttggagggacaatttttgataaggaaggttatagacacactgcagctgatttgttagagtatgctgatccaaagaaaatttcggtttatttgcatgcgac |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45938418 |
ttggtgggacaatttttgataaggaaggttatagacacactgcagctgatttgttagagtatgctgatccaaagaaaatttcggtttatttgcatgcgac |
45938517 |
T |
 |
| Q |
201 |
agttcaaaagatactattcaagtataataaaagtatgtatttaagaatgcctcatattaactttttatatctgccctaaattgtctttataaaatatact |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
45938518 |
agttcaaaagatactattcaagtataataaaagtatgtatttaagaatgcctcatattaactttttatatctaccctaaattgtctttataaaatatact |
45938617 |
T |
 |
| Q |
301 |
tgtaagatgatga |
313 |
Q |
| |
|
||||||||||||| |
|
|
| T |
45938618 |
tgtaagatgatga |
45938630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 10 - 223
Target Start/End: Original strand, 45945091 - 45945304
Alignment:
| Q |
10 |
caatggcaatcagcagtgagggatggtttacttgaagcaggggttttaccttacaatggttttgcttttgatcacttgtatgggactaaggttggaggga |
109 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||| |||| |||||||| |||||| | |||||||| | |||||||||||||||||||||| |
|
|
| T |
45945091 |
caatggcaatcagcagttagggacggtttacttgaagcagggattttgccttacaacggttttacatttgatcatgtatatgggactaaggttggaggga |
45945190 |
T |
 |
| Q |
110 |
caatttttgataaggaaggttatagacacactgcagctgatttgttagagtatgctgatccaaagaaaatttcggtttatttgcatgcgacagttcaaaa |
209 |
Q |
| |
|
||||||| |||||||||||| ||| |||||||||||||||||||||||||||||| |||||||||| |||||| |||||||||||||| ||||||||||| |
|
|
| T |
45945191 |
caattttcgataaggaaggtcataaacacactgcagctgatttgttagagtatgccgatccaaagagaatttctgtttatttgcatgccacagttcaaaa |
45945290 |
T |
 |
| Q |
210 |
gatactattcaagt |
223 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
45945291 |
gatactattcaagt |
45945304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 150
Target Start/End: Original strand, 3083442 - 3083582
Alignment:
| Q |
10 |
caatggcaatcagcagtgagggatggtttacttgaagcaggggttttaccttacaatggttttgcttttgatcacttgtatgggactaaggttggaggga |
109 |
Q |
| |
|
||||||||||||||||| || ||||| ||| | |||| ||| || || ||||||||||| ||| ||| ||||||| | ||||||||||||||||||| | |
|
|
| T |
3083442 |
caatggcaatcagcagttagagatggattattggaagtaggtgtgttgccttacaatggctttacttatgatcacattcatgggactaaggttggaggta |
3083541 |
T |
 |
| Q |
110 |
caatttttgataaggaaggttatagacacactgcagctgat |
150 |
Q |
| |
|
|||| ||||| | | ||| ||||||||||||| |||||| |
|
|
| T |
3083542 |
caatctttgaccataatggtcatagacacactgctgctgat |
3083582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 150
Target Start/End: Original strand, 3091882 - 3092022
Alignment:
| Q |
10 |
caatggcaatcagcagtgagggatggtttacttgaagcaggggttttaccttacaatggttttgcttttgatcacttgtatgggactaaggttggaggga |
109 |
Q |
| |
|
||||||||||||||||| || ||||| ||| | |||| ||| || || ||||||||||| ||| ||| |||||| | ||||||||||||||||||| | |
|
|
| T |
3091882 |
caatggcaatcagcagttagagatggattattggaagtaggtgtgttgccttacaatggctttacttatgatcatattcatgggactaaggttggaggta |
3091981 |
T |
 |
| Q |
110 |
caatttttgataaggaaggttatagacacactgcagctgat |
150 |
Q |
| |
|
|||| ||||| | | ||| |||||||||||||||||||| |
|
|
| T |
3091982 |
caatctttgaccataatggtcatagacacactgcagctgat |
3092022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University