View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6526_low_14 (Length: 245)
Name: NF6526_low_14
Description: NF6526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6526_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 18 - 243
Target Start/End: Original strand, 38053346 - 38053571
Alignment:
| Q |
18 |
agagacgtggtttgcataaggtcatttcaactcactcaaaaagcatctaagatggaatacaaagcaattgagagtgtgcttcaaactattaatcctcatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38053346 |
agagacgtggtttgcataaggtcatttcaactcactcaaaaagcatctaagatggaatacaaagcaattgagagtgtgcttcaaactattaatcctcatt |
38053445 |
T |
|
| Q |
118 |
ccggcgaggtatcactcttcttgggtatttttagcataaggtcattccagcttaagcaaaaaacactcgtttggccactgccattttatcagacttataa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| ||||||| |||| |
|
|
| T |
38053446 |
ccggcgaggtatcactcttcttgggtatttttagcataaggtcattccagcttaagcaaaaaacactcgtttggtcactgtcattttttcagactcataa |
38053545 |
T |
|
| Q |
218 |
cttattttcactgccttatagcttaa |
243 |
Q |
| |
|
|||||||||||| ||||||||||||| |
|
|
| T |
38053546 |
cttattttcactaccttatagcttaa |
38053571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University