View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6526_low_15 (Length: 243)
Name: NF6526_low_15
Description: NF6526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6526_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 121 - 240
Target Start/End: Original strand, 32430598 - 32430717
Alignment:
| Q |
121 |
tggttaggaagtgccgcatcatctggttgacatacttcatccatctgaaggtctgttttctttgatactaagctatatttgtttaagcaaggattcatat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32430598 |
tggttaggaagtgccgcatcatctggttgacatacttcatccatctgaaggtctgttttctttgatactaagctatatttgtttaagcaaggattcatat |
32430697 |
T |
|
| Q |
221 |
acgaatatcctcatattcat |
240 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
32430698 |
acgaatatcctcatattcat |
32430717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 32430478 - 32430547
Alignment:
| Q |
1 |
cttgctattgtgacttggattgcctgtcgtaactttttcgatttgttatttagtcgtaacatcgaattgg |
70 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32430478 |
cttgccattgtgacttggattgcctgtcgtaactttttcgatttgttatttagtcgtaacatcgaattgg |
32430547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University