View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6526_low_16 (Length: 235)

Name: NF6526_low_16
Description: NF6526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6526_low_16
NF6526_low_16
[»] chr4 (2 HSPs)
chr4 (178-230)||(49158544-49158596)
chr4 (1-53)||(49158722-49158774)


Alignment Details
Target: chr4 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 178 - 230
Target Start/End: Complemental strand, 49158596 - 49158544
Alignment:
178 gtctggagtttgaagaatgtgtgttggtgtgttgacccttttgatgatgatgt 230  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
49158596 gtctggagtttgaagaatgtgtgttggtgtgttgacccttttgatgatgatgt 49158544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 49158774 - 49158722
Alignment:
1 ccttagatggtgatgaatataatatattttggttcatgaatgaaatgctaccg 53  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
49158774 ccttagatggtgatgaatataatatattttggttcatgaatgaaatgctaccg 49158722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University