View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6527_high_21 (Length: 231)

Name: NF6527_high_21
Description: NF6527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6527_high_21
NF6527_high_21
[»] chr1 (2 HSPs)
chr1 (68-220)||(3451391-3451543)
chr1 (68-99)||(3451343-3451374)


Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 68 - 220
Target Start/End: Original strand, 3451391 - 3451543
Alignment:
68 gtgtatatgcttattattcctgtctcccatatcttcatagataagaaaactagtactagttcaattatgccttttttgtccatgtcgtgtgatcttcaac 167  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
3451391 gtgtatatgcttattattcctttctcccatatcttcatagataagaaaactagtactagttcgattatgccttttttgtccatgtcgtgtgatcttcaac 3451490  T
168 actcttgttctgatcatgttcacgagcacgcgaaacatcttctaccaatctct 220  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
3451491 actcttgttctgatcatgttcacgagcacgcgaaacatcttctaccaatctct 3451543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 68 - 99
Target Start/End: Original strand, 3451343 - 3451374
Alignment:
68 gtgtatatgcttattattcctgtctcccatat 99  Q
    ||||||||||||||||||||||||||||||||    
3451343 gtgtatatgcttattattcctgtctcccatat 3451374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University