View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6527_low_10 (Length: 336)
Name: NF6527_low_10
Description: NF6527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6527_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 16 - 323
Target Start/End: Complemental strand, 18980839 - 18980532
Alignment:
| Q |
16 |
atcatagattacagctaaaatggcagcaacaacctttccaaccgtcctaggaatggctggtgcatcacgtctcacctcaggtattttgtcattaagatat |
115 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18980839 |
atcatagattacagctgaaatggcagcaacaacctttccaaccgtcctaggaatggctggtgcatcacgtctcacctccggtattttgtcattaagatat |
18980740 |
T |
 |
| Q |
116 |
aataaacatgattttatgatatgtttgtatttattttaattgtaatttgtttgtaggatttgtgaaacctcaagtgattgctaggaatcctttgaagcaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18980739 |
aataaacatgattttatgatatgtttctatttattttaattgtaatttgtttgtaggatttgtgaaaccgcaagtgattgctaggaatcctttgaagcaa |
18980640 |
T |
 |
| Q |
216 |
gctatggcacttggaaatggtgggagagtcacatggtaaattttattataagattgatttgtatatatggttttcaaatataataaattttgatccatat |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18980639 |
gctatggcacttggaaatggtgggagagtcacatggtaaattttattataagattgatttgtatatatggttttcaaatataataaattttgatccatat |
18980540 |
T |
 |
| Q |
316 |
gaatattt |
323 |
Q |
| |
|
|||||||| |
|
|
| T |
18980539 |
gaatattt |
18980532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University