View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6527_low_11 (Length: 318)
Name: NF6527_low_11
Description: NF6527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6527_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 17 - 192
Target Start/End: Original strand, 11382346 - 11382522
Alignment:
| Q |
17 |
aactctagtgtggagtttgtgtaaa-ataagcaaataagattgtccatgatcttgctaaagcggcgacaaataccgtgagtgttatgattaatgccgacg |
115 |
Q |
| |
|
|||||||| |||||||||||| ||| |||| ||||||||||||| |||||||||||||||| ||| | | ||||||| |||||||| ||||||||||| | |
|
|
| T |
11382346 |
aactctagcgtggagtttgtgcaaagataaacaaataagattgttcatgatcttgctaaagtggccatatataccgttagtgttataattaatgccgatg |
11382445 |
T |
 |
| Q |
116 |
atacttagcaagataatgcttgattgttatcgttgtacggatttataatgattatattttaattaatgaaatgctat |
192 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| | |||||||||||| |||||||||| ||||||||||| |
|
|
| T |
11382446 |
atacttagcaagataatgtttgattgttatcgttgtacgaaattataatgattaaattttaattattgaaatgctat |
11382522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 212 - 305
Target Start/End: Original strand, 11382581 - 11382674
Alignment:
| Q |
212 |
atagtttgtataagctgaagtatacaaaccgagttaaatgagaatccttttgaagcagaagtagtgattgtgctctgtcttcgttgtatacttc |
305 |
Q |
| |
|
|||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11382581 |
atagtttgtataagctaaagtatgcaaaccgaattaaatgagaatccttttgaagcagaagtagtgattgtgctctgtcttcgttgtatacttc |
11382674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University