View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6527_low_20 (Length: 245)
Name: NF6527_low_20
Description: NF6527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6527_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 21 - 231
Target Start/End: Original strand, 4817459 - 4817669
Alignment:
| Q |
21 |
atgggagacattagaacctcaaagaacaaacagaaaaaataaacagaaactagtttgatccattatttattttagtataaaatgcaagcccttcttcatt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4817459 |
atgggagacattagaacctcaaagaacaaacagaaaaaataaacagaaactagtttgatccattatttattttagtataaaatgcaagtccttcttcatt |
4817558 |
T |
 |
| Q |
121 |
gcaaacacaccatcacctttaattaaagtaaattaattttcatatattcataccaacaatatcaagaacaatggcaaagtctacaatcccccttgtcttc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4817559 |
gcaaacacaccatcacctttaattaaagtaaattaattttcatatactcataccaacaatatcaagaacaatggcaaagtctacaatcccccttgtcttc |
4817658 |
T |
 |
| Q |
221 |
accctttgctt |
231 |
Q |
| |
|
||||||||||| |
|
|
| T |
4817659 |
accctttgctt |
4817669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University