View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6527_low_27 (Length: 207)
Name: NF6527_low_27
Description: NF6527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6527_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 1e-55; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 15 - 136
Target Start/End: Original strand, 14157631 - 14157752
Alignment:
| Q |
15 |
ttattcttctgcagtttatattccttgaatgaagtgcttatcattcttttcctatatacgatctgctgtgaccattctatttgccgtgttgttgctgaga |
114 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
14157631 |
ttatacttctgcagtttatattccttgaatgaagtgcttatcattcttttcctatatacgatctgctgtgatcattctatttgccgtgttgttgctgaga |
14157730 |
T |
 |
| Q |
115 |
attcgatctgcggatagaattt |
136 |
Q |
| |
|
||||||||||| |||||||||| |
|
|
| T |
14157731 |
attcgatctgctgatagaattt |
14157752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 15 - 56
Target Start/End: Original strand, 14141901 - 14141942
Alignment:
| Q |
15 |
ttattcttctgcagtttatattccttgaatgaagtgcttatc |
56 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14141901 |
ttatacttctgcagtttatattccttgaatgaagtgattatc |
14141942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 81 - 135
Target Start/End: Complemental strand, 14157784 - 14157730
Alignment:
| Q |
81 |
tgtgaccattctatttgccgtgttgttgctgagaattcgatctgcggatagaatt |
135 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||| ||| || ||| ||||| |
|
|
| T |
14157784 |
tgtgatcattctatttgccgtgttgttgctgaaaattctatcagcagatcgaatt |
14157730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University