View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6528_low_4 (Length: 250)
Name: NF6528_low_4
Description: NF6528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6528_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 69 - 244
Target Start/End: Original strand, 34988498 - 34988673
Alignment:
| Q |
69 |
catcttcacgattattcctaaataactcacttgattgctcaacttctgattgcaagtggtcactacgaggttgaaaatctttcactataacttcactgtc |
168 |
Q |
| |
|
|||| |||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34988498 |
catcatcactattattcctaaataaatcacttgattgctcaacttctgattgcaagtggtcactacgaggttgaaaatctttcactataacttcactgtc |
34988597 |
T |
|
| Q |
169 |
acttaccacattttctcctacaacctttccaactacagatgcatcgtttatttcagttgtgtcattactgatgatg |
244 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34988598 |
atttaccacattttctcctacaacctttccaactacagatgcatcgtttatttcagttgtgtcattactgatgatg |
34988673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 198 - 244
Target Start/End: Complemental strand, 23988258 - 23988212
Alignment:
| Q |
198 |
caactacagatgcatcgtttatttcagttgtgtcattactgatgatg |
244 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||| |||||||| |
|
|
| T |
23988258 |
caactacagatggattgtttatttcagttgtgtcattattgatgatg |
23988212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 200 - 244
Target Start/End: Original strand, 33053888 - 33053932
Alignment:
| Q |
200 |
actacagatgcatcgtttatttcagttgtgtcattactgatgatg |
244 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||| |||||||| |
|
|
| T |
33053888 |
actacagattcatcgtttatttcagttatgtcattattgatgatg |
33053932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University