View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6529_high_18 (Length: 251)
Name: NF6529_high_18
Description: NF6529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6529_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 47933784 - 47933554
Alignment:
| Q |
1 |
acaaaggtaacagaggagcttttccgttcaaaatattttacaaacacactaaatcagtgctagagtgtagtcttagggtgaaaaagagttaaggtcgcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47933784 |
acaaaggtaacagaggagcttttccgttcaaaatattttacaaacacactaaatcagtgctagagtgtagtcttagggtgaaaaagagttaaggtcgcca |
47933685 |
T |
 |
| Q |
101 |
acagtgctgaaaactctatacaaggctttcactattgatgatacagtgtaaggaacaaagggtaggaatgtgaaagaatttgaaacaatatggtatgcaa |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47933684 |
acagtgctgaaaactctatgtaaggctttcactattgatgatacagtgtaatgaacaaagggtaggaatgtgaaagaatttgaaacaat-tggtatgcaa |
47933586 |
T |
 |
| Q |
201 |
gaacttgaggcacttccaaactataatatatt |
232 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |
|
|
| T |
47933585 |
gaacttgaggcacttccgaactataatatatt |
47933554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University