View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6529_high_19 (Length: 245)
Name: NF6529_high_19
Description: NF6529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6529_high_19 |
 |  |
|
| [»] scaffold0223 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0223 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 12 - 229
Target Start/End: Complemental strand, 21021 - 20813
Alignment:
| Q |
12 |
atgagaggtgactcatgcaaacaaggtacaaaacaatgtctctcaccttccttagtataaagctttaatatttattattgtttactagagtattttcaga |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |||||||| |
|
|
| T |
21021 |
atgagaggtgactcatgcaaacaaggtacaaaacaatgtctctcaccttccttagtataaagctttaatatttattattctttattagagtgttttcaga |
20922 |
T |
 |
| Q |
112 |
tcattgttcttttgtttaaaattttattcattagaatgtcatgatacattgatgcatgatgcatgatgctttatgcattcaagctaggcatgcttacatg |
211 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20921 |
tcattg---ttttgtttaaaattttattcattagaatgtcatgatacatt------tgatgcatgatgctttatgcattcaagctaggcatgcttacatg |
20831 |
T |
 |
| Q |
212 |
acttttgtggttaaaaat |
229 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
20830 |
acttttgtggttaaaaat |
20813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University