View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6529_high_4 (Length: 427)
Name: NF6529_high_4
Description: NF6529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6529_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 75 - 421
Target Start/End: Complemental strand, 49363919 - 49363573
Alignment:
| Q |
75 |
gctctgagagattccggtgatttgtctgagaatgcaacagcatatgtcagcttagagccttgtaatcattttgggaggactccaccttgcactgaagctc |
174 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49363919 |
gctctgagagatgccggtgatttgtctgagaatgcaacagcatatgtcagcttagagccttgtaatcattttgggaggactccaccttgcactgaagctc |
49363820 |
T |
 |
| Q |
175 |
tcatcaaagccaaaattaaaaaggttgttattgggatggtggatccaaatcctattgttgcctccaaaggggtggatagattgagagatgccggaataga |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
49363819 |
tcatcaaagccaaaattaaaaaggttgttattgggatggtggatccaaatcctattgttgcctccaaaggggtggatagattgagagatgccggaattga |
49363720 |
T |
 |
| Q |
275 |
agttgttgttggtgtcgaggaagaattgtgcaagagcctcaatgaggcatatattcatcacatgttgaccggaaagcctctgcttactttgaggtaattc |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49363719 |
agttgttgttggtgtcgaggaagaattgtgcaagagcctcaatgaggcatatattcatcacatgttgaccggaaagcctctgcttactttgaggtaattc |
49363620 |
T |
 |
| Q |
375 |
aattccacttgcttttcactaaagattcatttgtggatgttttcgat |
421 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49363619 |
aattccacttgcttttcactaaagattcatttgtggatgttttcgat |
49363573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University