View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6529_high_8 (Length: 331)
Name: NF6529_high_8
Description: NF6529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6529_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 1 - 321
Target Start/End: Original strand, 47933773 - 47934093
Alignment:
| Q |
1 |
tgttacctttgtttatgggttcttgtcagtgagcccgccattggattcttctattttgccttctaattaaccatttgttgcccttctagaacatcggttg |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47933773 |
tgttacctttgtttatggtttcttgtcagtgagcccgccattggattcttctcttttgccttctaattaaccatttgttgcccttctagaacatcggttg |
47933872 |
T |
 |
| Q |
101 |
agggtttcgtcattgttagtgctactacctcgccattacccctgacagttattttcgaatataccagttttgatgcaatggtaaagttgctgtcacgtaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
47933873 |
agggtttcgtcattgttagtgctactacctcgccaatacccctgacagttattttcgaatataccagctttgatgcaatggtaaagttgttgtcacgtaa |
47933972 |
T |
 |
| Q |
201 |
ctaaaagggtatttaggtcttgagaacaccctctggtgtaaacaacacggaagcagcgcacaatataccaattgattggacccccttcctagaacggctc |
300 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47933973 |
ctaaaaaggtatttaagtcttgagaacaccctctggtgtaaacatcacggaagcagcgcacaatataccaattgattggacccccttcctagaacggctc |
47934072 |
T |
 |
| Q |
301 |
atttactagaacggctctctg |
321 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
47934073 |
atttactagaatggctctctg |
47934093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University