View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6529_low_23 (Length: 235)
Name: NF6529_low_23
Description: NF6529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6529_low_23 |
 | |
|
| [»] scaffold0148 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0148 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: scaffold0148
Description:
Target: scaffold0148; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 16 - 235
Target Start/End: Complemental strand, 28395 - 28176
Alignment:
| Q |
16 |
ctgtgggagagctttgaaaatccaactgacacattcctacttggaatgaatatggataagaatttgagtctgactagttggaaaggtgctgatgacccaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28395 |
ctgtgggagagctttgaaaatccaactgacacattcctacttggaatgaatatggataagaatttgagtctgactagttggaaaggtgctgatgacccaa |
28296 |
T |
|
| Q |
116 |
gcagtggggatttcacttttaagacaatggacaaccgtttcatcatcttaaaccgaagtgaaattcattgggagagcgaagagcacggaaagcatgatca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28295 |
gcagtggggatttcacttttaagacaatggacaaccgtttcatcatcttaaaccgaagtgaaattcattgggagagcgaagagcacggaaagcatgatca |
28196 |
T |
|
| Q |
216 |
attggacgacatcagctttg |
235 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
28195 |
attggacgacatcagctttg |
28176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University