View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6529_low_24 (Length: 227)
Name: NF6529_low_24
Description: NF6529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6529_low_24 |
 | |
|
| [»] scaffold0148 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0148 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: scaffold0148
Description:
Target: scaffold0148; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 27975 - 28186
Alignment:
| Q |
1 |
aacatttgcttcttggctgcttccatataactggcaaatcatcttccacccactgtatcacacctgtcgaattgaggaacaatcttttattgttatactg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27975 |
aacatttgcttcttggctgcttccatataactagcaaatcatcttccacccactgtatcacacctgtggaattgaggaacaatcttttattgttatactg |
28074 |
T |
|
| Q |
101 |
ttcgttacgaattactgatctgttccgtttttcaggtgaactgaatttgtttgacgaattataaacaagaaaactgaagttggtcaacaaattataaacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28075 |
ttcgttacgaattactgatctgttccgtttttcaggtgaactgaatttgtttgacgaattataaacaagaaaactgaagttggtcaacaaattataaacc |
28174 |
T |
|
| Q |
201 |
tcaaagctgatg |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
28175 |
tcaaagctgatg |
28186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University