View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6530_high_9 (Length: 301)
Name: NF6530_high_9
Description: NF6530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6530_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 19 - 293
Target Start/End: Complemental strand, 7792174 - 7791896
Alignment:
| Q |
19 |
gaagcagattccaaagtgacatcccttacatgca----agtacacctgc-tgccagaaaacgctattaaaacagctttggctnnnnnnnnnnnntctgac |
113 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| ||||||||||| |||||||||||||||||||| ||||||||||| || ||| |
|
|
| T |
7792174 |
gaagcagattccgaagtggcatcccttacatgcatgcaagtacacctgcctgccagaaaacgctattaaa-cagctttggctaaaaataaaaaatcggac |
7792076 |
T |
|
| Q |
114 |
acctcagattcattttctttctttcactcacagtttccccctttcctcttctctcccctcccaccatagttgagcctttccagatccaaattgcataagc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7792075 |
acctcagattcattttctttctttcactcacagtttacccctttcctcttctctcccctcccatcatagttgagcctttccagatccaaattgcataagc |
7791976 |
T |
|
| Q |
214 |
taatttttcttattctatccacctttagaccaaacctttcaagatccaaatccccaaacccataaattgttcttcttctc |
293 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7791975 |
taacttttcttattctatccacctttagaccaaaccattcaagatccaaatccccaaacccataaattgttcttcttctc |
7791896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University