View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6530_low_11 (Length: 252)
Name: NF6530_low_11
Description: NF6530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6530_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 38040419 - 38040219
Alignment:
| Q |
1 |
ttcaggaagctcaaacttttgtattttcttttgaagcatttccactccatagaatttcaccacatttttggtcttgagtaattcttttgtagtcatgtca |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38040419 |
ttcaggaagctcaagcttttgtattttcttttgaagcatttccactccatagaatttcaccacatttttggtcttcagtaattcttttgtagtcatgtca |
38040320 |
T |
 |
| Q |
101 |
attttctcaaatccaaaacatgaagtccaagtctgtagtacttgcatcgctgatggaatgaccagcatctccacattcatatagctcagtgcctgcatgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38040319 |
attttctcaaatccaaaacatgaagtccaagtctgtagtacttgcatcgctgatggaatgaccagcatctccacattcatatagctcagtgcctgcatgc |
38040220 |
T |
 |
| Q |
201 |
a |
201 |
Q |
| |
|
| |
|
|
| T |
38040219 |
a |
38040219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 202 - 243
Target Start/End: Complemental strand, 38016355 - 38016314
Alignment:
| Q |
202 |
ccctgcactctattgaaggcgtgagactgaacaatcatgatg |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38016355 |
ccctgcactctattgaaggcgtgagactgaacaatcatgatg |
38016314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University