View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6530_low_14 (Length: 239)

Name: NF6530_low_14
Description: NF6530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6530_low_14
NF6530_low_14
[»] chr4 (1 HSPs)
chr4 (1-222)||(2722453-2722672)


Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 2722672 - 2722453
Alignment:
1 tcatgtgtcttgaatctgaataacttaggaacaaaacaaaatgaaagaaaggctcagcactgagaattataatcgaaatgacaactaaatattctaaatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2722672 tcatgtgtcttgaatctgaataacttaggaacaaaacaaaatgaaagaaaggctcagcactgagaattataatcgaaatgacaactaaatattctaaatt 2722573  T
101 ctttttaagatttattatatgtgtgcttttggactttagtcatttctgctcccttataaaccctaagcaattaagcataagtaataatcaaaacccaaat 200  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2722572 ctttttaagatttattata--tgtgcttttggactttagtcatttctgctcccttataaaccctaagcaattaagcataagtaataatcaaaacccaaat 2722475  T
201 taagtaattggcataagaatag 222  Q
    ||||||||||||||||||||||    
2722474 taagtaattggcataagaatag 2722453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University