View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6530_low_14 (Length: 239)
Name: NF6530_low_14
Description: NF6530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6530_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 2722672 - 2722453
Alignment:
| Q |
1 |
tcatgtgtcttgaatctgaataacttaggaacaaaacaaaatgaaagaaaggctcagcactgagaattataatcgaaatgacaactaaatattctaaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2722672 |
tcatgtgtcttgaatctgaataacttaggaacaaaacaaaatgaaagaaaggctcagcactgagaattataatcgaaatgacaactaaatattctaaatt |
2722573 |
T |
 |
| Q |
101 |
ctttttaagatttattatatgtgtgcttttggactttagtcatttctgctcccttataaaccctaagcaattaagcataagtaataatcaaaacccaaat |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2722572 |
ctttttaagatttattata--tgtgcttttggactttagtcatttctgctcccttataaaccctaagcaattaagcataagtaataatcaaaacccaaat |
2722475 |
T |
 |
| Q |
201 |
taagtaattggcataagaatag |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2722474 |
taagtaattggcataagaatag |
2722453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University