View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6532_low_4 (Length: 269)
Name: NF6532_low_4
Description: NF6532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6532_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 37027984 - 37028249
Alignment:
| Q |
1 |
tgtgtggcaaagcctacagttcctgatcctataattcaagtggctatggactatgcctgtgggtctggggctgactgtaaatcagttcagcctaatggga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37027984 |
tgtgtggcaaagcctacagttcctgatcctataattcaagtggctatggattatgcctgtgggtctggggctgactgtaaatcagttcagcctaatggga |
37028083 |
T |
 |
| Q |
101 |
tatgctttcagcccaacacagtgttggcacatgcttcttatgcattcaatagctattggcagaacactaagattggtggggggacttgtgattttggtgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37028084 |
tatgctttcagcccaacacagtgttggcacatgcttcttatgcatttaatagctattggcagaacactaagattggtggggggacttgtgattttggtgg |
37028183 |
T |
 |
| Q |
201 |
tactgctatgcttgtcactgttgatccaagtaagtttgcac----taccatatttgattacctttg |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37028184 |
tactgctatgcttgtcactgttgatccaagtaagtttgcactacgtaccatatttgattacctttg |
37028249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University