View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6532_low_7 (Length: 243)

Name: NF6532_low_7
Description: NF6532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6532_low_7
NF6532_low_7
[»] chr7 (1 HSPs)
chr7 (129-169)||(16978144-16978184)


Alignment Details
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 129 - 169
Target Start/End: Original strand, 16978144 - 16978184
Alignment:
129 tccaaatcaacaaagtttttatctttatcatcaaactcacc 169  Q
    |||||||||||||||||||||||||||||||||||||||||    
16978144 tccaaatcaacaaagtttttatctttatcatcaaactcacc 16978184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University