View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6533_high_23 (Length: 395)
Name: NF6533_high_23
Description: NF6533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6533_high_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 340; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 49 - 392
Target Start/End: Original strand, 24899728 - 24900071
Alignment:
| Q |
49 |
caaggcggttagtgttgtgtttgagttgatgaagtatgaccctcgtcaagccgaatgatgatcttattccagagcactatatgtttttattgtaacaact |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24899728 |
caaggcggttagtgttgtgtttgagttgatgaagtatgaccctcgtcaagccgaatgatgatcttattccagagcactatatgtttttattgtaacaact |
24899827 |
T |
 |
| Q |
149 |
ttggggcctgaaatatattcatgcaggtatccttcgaattgagtttttggcgtttgcaggtatggccgtatgggtcctaaaggaggaattagcaactctg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24899828 |
ttggggcctgaaatatattcatgcaggtatccttcgaattgagtttttggcgtttgcaggtatggccgtatgggtcctaaaggaggaattagcaactctg |
24899927 |
T |
 |
| Q |
249 |
aaattgactctggtaagcctgatttgctctcttgcttggctgctttgcttcttttgggtcagaatttctgtggcaccccttgtatactgttgttgtagat |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24899928 |
aaattgactctggtaagcctgatttgctctcttgcttggctgctttgcttcttttgggtcggaatttctgtggcaccccttgtatactgttgttgtagat |
24900027 |
T |
 |
| Q |
349 |
ggttcttaaactttcggtctggtttgtattgctggtgtgttcat |
392 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24900028 |
ggttcttaaactttcggtctggtttgtattgctggtgtgttcat |
24900071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University