View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6533_high_55 (Length: 254)

Name: NF6533_high_55
Description: NF6533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6533_high_55
NF6533_high_55
[»] chr4 (1 HSPs)
chr4 (166-254)||(1234237-1234325)


Alignment Details
Target: chr4 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 166 - 254
Target Start/End: Original strand, 1234237 - 1234325
Alignment:
166 catttacaattcatatttgttggaaaattgcacgcacctctttcatgtctatttagacctagacacacattttctataaagtatgtctt 254  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
1234237 catttacaattcatatttgttggaaaattgcacgcacctctttcatgtctacttagacctagacacacattttctataaagtatgtctt 1234325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University