View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6533_high_66 (Length: 243)

Name: NF6533_high_66
Description: NF6533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6533_high_66
NF6533_high_66
[»] chr4 (2 HSPs)
chr4 (133-218)||(1234341-1234426)
chr4 (1-30)||(1234304-1234333)


Alignment Details
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 133 - 218
Target Start/End: Original strand, 1234341 - 1234426
Alignment:
133 ttatctcggtttttgatttgagattgatcaacttatattcatataattacacaatatatgtaaccatgtaaataattttgcttttg 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||    
1234341 ttatctcggtttttgatttgagattgatcaacttatattcatataattacacagtatatgtaaccatgcaaataattttgcttttg 1234426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 1234304 - 1234333
Alignment:
1 cattttctataaagtatgtcttatttagtt 30  Q
    ||||||||||||||||||||||||||||||    
1234304 cattttctataaagtatgtcttatttagtt 1234333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University