View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6533_high_67 (Length: 243)
Name: NF6533_high_67
Description: NF6533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6533_high_67 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 89 - 135
Target Start/End: Original strand, 9526216 - 9526262
Alignment:
| Q |
89 |
tttctctaggagtggggttaaagattaaaaggttcttagaggtgaaa |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9526216 |
tttctctaggagtggggttaaagattaaaaggttcttagaggtgaaa |
9526262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 9526188 - 9526220
Alignment:
| Q |
1 |
atgagcatgttcctgcacaggtttttcatttct |
33 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
9526188 |
atgagcatgttcctgcacaggtttttcatttct |
9526220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University