View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6533_high_84 (Length: 210)
Name: NF6533_high_84
Description: NF6533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6533_high_84 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 35; Significance: 0.00000000007; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 156 - 194
Target Start/End: Complemental strand, 30773510 - 30773472
Alignment:
| Q |
156 |
taagtcttgagtttttatgatttgtattaggactttttg |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30773510 |
taagtcttgagtttttatgatttgtattaggattttttg |
30773472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 54 - 97
Target Start/End: Complemental strand, 30774467 - 30774424
Alignment:
| Q |
54 |
gaataagaatatatattgacaggaataattttgttttgttgatc |
97 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
30774467 |
gaataagaatatatcctgataggaataattttgttttgttgatc |
30774424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 152 - 188
Target Start/End: Complemental strand, 17983441 - 17983405
Alignment:
| Q |
152 |
ctattaagtcttgagtttttatgatttgtattaggac |
188 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17983441 |
ctattaagtcttgagtttttattatttgtattaggac |
17983405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 152 - 188
Target Start/End: Complemental strand, 2997185 - 2997149
Alignment:
| Q |
152 |
ctattaagtcttgagtttttatgatttgtattaggac |
188 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2997185 |
ctattaagtcttgagtttttattatttgtattaggac |
2997149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University