View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6533_low_33 (Length: 358)
Name: NF6533_low_33
Description: NF6533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6533_low_33 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 19 - 346
Target Start/End: Original strand, 8205150 - 8205477
Alignment:
| Q |
19 |
actaaggaccccatctccatcaatatcaaattgagaaatcatagcttgacactcatctatacttctacactcacccaatcttccaagcattctctttaga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8205150 |
actaaggaccccatctccatcaatatcaaattgagaaatcatagcttgacattcatctacacttctacactcacccaatcttccaagcattctctttaga |
8205249 |
T |
|
| Q |
119 |
ctctttggtgtgatgcaaccacatccctccatttcatacatcttaaaagcctctcttaggtcatttactttctcttcctctttccctccctctacaaact |
218 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8205250 |
ctctttggtgtgatgcaaccacatccttccatttcatacatcttaaaagcctctcttaggtcatttactttctcttcctctttccctccctctacaaact |
8205349 |
T |
|
| Q |
219 |
tcacaaaatcatccaacccaatcaacccatcaccgtccgagtcgagaagctcaaccgccatttccgcctcctcgttcgacatctttgccccgattgcctc |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8205350 |
tcacaaaatcatccaacccaatcaacccatccccgtccgagtcgagaagctcaaccgccatttccgcctcctcgtttgacatctttgccccgattgcctc |
8205449 |
T |
|
| Q |
319 |
aacacattgccgcagctccgatgatgat |
346 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
8205450 |
aacacattgccgcagctccgatgatgat |
8205477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University