View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6533_low_50 (Length: 294)
Name: NF6533_low_50
Description: NF6533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6533_low_50 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 283
Target Start/End: Original strand, 41986183 - 41986464
Alignment:
| Q |
1 |
cctggagcagttccatatgcacagttgtgactcggtcggttctggttcttcttccatgatgaaggaggttcccaa-tggacgacatgggaaaatttgttg |
99 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || ||||||||| |
|
|
| T |
41986183 |
cctggagcagttccat--gcacagttgtgactcggtcggttctggttcttcttccatgatgaaggaggttcccaaatggacgacatgagagaatttgttg |
41986280 |
T |
 |
| Q |
100 |
aagtcaagcacgtaaggaaaatcataagggcaaggatactcacatgggcggaggggatggaagagttgtgtttcgccacatgaattttgggtaattctaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41986281 |
aagtcaagcacgtaaggaaaatcataagggcaaggatactcacatgggcggagtggatggaagagttgtgtttccccacatgaattttgggtaattctaa |
41986380 |
T |
 |
| Q |
200 |
tcaaccagggacggagattttgttgttgcgttggtggtttgatgagtaagagactgtgttttgagaggaaataggatgatgatg |
283 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41986381 |
tcaaccagggacggagattttgttgttgtggtggtggtttgatgagtaagagactgtgttttgagaggaaataggatgatgatg |
41986464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 148 - 215
Target Start/End: Complemental strand, 44688249 - 44688182
Alignment:
| Q |
148 |
cggaggggatggaagagttgtgtttcgccacatgaattttgggtaattctaatcaaccagggacggag |
215 |
Q |
| |
|
||||| || ||||||||||||||||| || | ||| |||| |||||||||||||||||| |||||||| |
|
|
| T |
44688249 |
cggagtgggtggaagagttgtgtttctccgcgtgagtttttggtaattctaatcaaccaaggacggag |
44688182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University