View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6533_low_52 (Length: 285)

Name: NF6533_low_52
Description: NF6533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6533_low_52
NF6533_low_52
[»] chr6 (2 HSPs)
chr6 (22-75)||(21263009-21263062)
chr6 (180-255)||(33700568-33700643)


Alignment Details
Target: chr6 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 22 - 75
Target Start/End: Complemental strand, 21263062 - 21263009
Alignment:
22 aagcctaaaatggattggattttaatacaaaagtagaatacatgtgatatgtgc 75  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||    
21263062 aagcctaaaatggattggatttcaatacaaaagtagaatacatgtgatatgtgc 21263009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 180 - 255
Target Start/End: Complemental strand, 33700643 - 33700568
Alignment:
180 ctagtttccaccaaaaatctatgctatcacctaaaatattaatatagtttgaaaaagacctgaccataaaatttag 255  Q
    |||||||  ||| ||||||| ||||||||| |||  || ||||||| |||| ||||||||||||| ||||||||||    
33700643 ctagttttaacctaaaatctctgctatcacataaggtagtaatataatttgcaaaagacctgaccgtaaaatttag 33700568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University