View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6533_low_59 (Length: 263)
Name: NF6533_low_59
Description: NF6533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6533_low_59 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 69 - 219
Target Start/End: Complemental strand, 3590474 - 3590324
Alignment:
| Q |
69 |
taatatgtattttttaaaaataatcaaatatgtccctattagggaataaattttcccttagtcaatgtattacttccgacataatactcatttaattttc |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3590474 |
taatatgtattttttaaaaataatcaaatatgtccctattagagaataaattttcccttagtcaatgtattacttccgacataatactcatttaattttc |
3590375 |
T |
|
| Q |
169 |
caatccatatgtaccactagtcaaagacatactcgcaactattataaagaa |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3590374 |
caatccatatgtaccactagtcaaagacatactcgcaactattataaagaa |
3590324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University