View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6533_low_71 (Length: 245)
Name: NF6533_low_71
Description: NF6533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6533_low_71 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 15 - 245
Target Start/End: Complemental strand, 25036614 - 25036383
Alignment:
| Q |
15 |
aatatgttcacatccatgacttttctcaacataaatagagcatgtaggacatctctgccatgattctcttttgaccaactccaaaaatttcctatcattt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25036614 |
aatatgttcacatccatgacttttctcaacataaatagagcatgtaggacatctctgccatgattctcttttgaccaactccaaaaatttcctatcattt |
25036515 |
T |
 |
| Q |
115 |
tcaacttcatctttcatcttcaccagtt-ttttactatacacatcatattttgagtcccaccatttatagggatttggctatttggttcccatagtaaag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25036514 |
tcaacttcatctttcatcttcaccagtttttttactatacacatcatattttgagtcccaccatttatagggatttggctatttggttcccatagtaaag |
25036415 |
T |
 |
| Q |
214 |
gagtnnnnnnnggggtcagcataacaaaattg |
245 |
Q |
| |
|
|||| ||||||||||||||||||||| |
|
|
| T |
25036414 |
gagtaaaaaaaggggtcagcataacaaaattg |
25036383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 43 - 110
Target Start/End: Complemental strand, 26104501 - 26104434
Alignment:
| Q |
43 |
acataaatagagcatgtaggacatctctgccatgattctcttttgaccaactccaaaaatttcctatc |
110 |
Q |
| |
|
||||| ||||||||| | ||||||||||||||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
26104501 |
acatacatagagcatcttggacatctctgccatttttctcttttagccaactccaaaaatttcatatc |
26104434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University