View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6533_low_72 (Length: 243)
Name: NF6533_low_72
Description: NF6533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6533_low_72 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 133 - 218
Target Start/End: Original strand, 1234341 - 1234426
Alignment:
| Q |
133 |
ttatctcggtttttgatttgagattgatcaacttatattcatataattacacaatatatgtaaccatgtaaataattttgcttttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
1234341 |
ttatctcggtttttgatttgagattgatcaacttatattcatataattacacagtatatgtaaccatgcaaataattttgcttttg |
1234426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 1234304 - 1234333
Alignment:
| Q |
1 |
cattttctataaagtatgtcttatttagtt |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1234304 |
cattttctataaagtatgtcttatttagtt |
1234333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University