View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6533_low_78 (Length: 239)
Name: NF6533_low_78
Description: NF6533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6533_low_78 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 16 - 99
Target Start/End: Complemental strand, 7422367 - 7422284
Alignment:
| Q |
16 |
cactctctgctttgcgttctttgatgtcttctcactctccacctcttcatgccttagttgttccttctgaagattatcaccagg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7422367 |
cactctctgctttgcgttctttgatgtcttctcactctccacctcttcatgccttagttgttccttctgaagattatcaccagg |
7422284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 178 - 239
Target Start/End: Complemental strand, 7422209 - 7422148
Alignment:
| Q |
178 |
tctaatctgatctttattttatgcgatgataattgttgtaatttgcagagtgaatatgtatc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7422209 |
tctaatctgatctttattttatgcgatgataattgttgtaatttgcagagtgaatatgtatc |
7422148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University