View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6533_low_78 (Length: 239)

Name: NF6533_low_78
Description: NF6533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6533_low_78
NF6533_low_78
[»] chr5 (2 HSPs)
chr5 (16-99)||(7422284-7422367)
chr5 (178-239)||(7422148-7422209)


Alignment Details
Target: chr5 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 16 - 99
Target Start/End: Complemental strand, 7422367 - 7422284
Alignment:
16 cactctctgctttgcgttctttgatgtcttctcactctccacctcttcatgccttagttgttccttctgaagattatcaccagg 99  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7422367 cactctctgctttgcgttctttgatgtcttctcactctccacctcttcatgccttagttgttccttctgaagattatcaccagg 7422284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 178 - 239
Target Start/End: Complemental strand, 7422209 - 7422148
Alignment:
178 tctaatctgatctttattttatgcgatgataattgttgtaatttgcagagtgaatatgtatc 239  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7422209 tctaatctgatctttattttatgcgatgataattgttgtaatttgcagagtgaatatgtatc 7422148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University