View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6533_low_81 (Length: 238)
Name: NF6533_low_81
Description: NF6533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6533_low_81 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 38 - 221
Target Start/End: Original strand, 29015087 - 29015272
Alignment:
| Q |
38 |
atctccatctccctactcgaatgtatcattgtgattgggagtgaga--agtgcaaagtataaatacgagcattaacaatcatgtgcacacatatcattta |
135 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
29015087 |
atctccatctccctactcgaatgcatcattgtgattgggagtgagagaagtgcaaagtataaatacgagcattaacaatcatgtgcacacatatcaatta |
29015186 |
T |
 |
| Q |
136 |
tatcctaaaaaagatcagtctaatcaatccctccatgtgcttacttctttgttcactctaacttgataatgataaaaacatttcat |
221 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29015187 |
tatcctaaaaaagatcagtctaatcaatctctccatgtgcttacttctttgttcactctaacttgataatgataaaaacatttcat |
29015272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University