View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6533_low_83 (Length: 234)
Name: NF6533_low_83
Description: NF6533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6533_low_83 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 14 - 220
Target Start/End: Complemental strand, 55301129 - 55300923
Alignment:
| Q |
14 |
cctctttcaaatctgttgtctctgtatttattagtacattctcattcccaacttgtgacgcacgactctctctcaatggcttctcttgttcaatcatcac |
113 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55301129 |
cctctttcaaacctgttgtctctgtatttattagtacattctcattcccaacttgtgacgcacgactctctctcaatggcttctcttgttcaatcatcac |
55301030 |
T |
|
| Q |
114 |
caattccatctcctcctccatacccaaatctgttttgtcagcattttcttgttgtgacaatactgtctccgaatttgatgttactctctccctcaaatgc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
55301029 |
caattccatctcctcctccatacccaaatctgttttgtcagcattttcttgttgtgacaatactgtctccgaatttgatgttactctctccctcaaaggc |
55300930 |
T |
|
| Q |
214 |
tttctct |
220 |
Q |
| |
|
||||||| |
|
|
| T |
55300929 |
tttctct |
55300923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University