View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6533_low_84 (Length: 231)
Name: NF6533_low_84
Description: NF6533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6533_low_84 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 82 - 223
Target Start/End: Complemental strand, 35425233 - 35425092
Alignment:
| Q |
82 |
gctgctttataaattgttaggattctcttaatatcatccacttctctattttgctctgtnnnnnnnngtcatctgcaaataaaaaatgtataatacacga |
181 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35425233 |
gctgcttcataaattgttaggattctcttaatatcatccacttctctattttgctctgtaaaaaaaagtcatctgcaaataaaaaatgtataatacacga |
35425134 |
T |
 |
| Q |
182 |
tgctcctctacaaattttaacatcatgtaaatcccttcttct |
223 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35425133 |
tgctcctctacaaattttaacaccatgtaaatcccttcttct |
35425092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 35425351 - 35425287
Alignment:
| Q |
1 |
cattgacatgtcaagaataatctcgtccccaagaatataggttattttgttcttcaatgtatcat |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35425351 |
cattgacatgtcaagaataatctcgtccccaagaatataggttatttggttcttcaatgtatcat |
35425287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University